Announcements of DNA Projects - Family History & Genealogy Message Board

Polglase DNA

duncansbrook — 30 Sep 2007 1:57:01 GMT

Y-DNA: Haplogroup R1b, DYS19=16

iamflj — 31 Dec 2008 8:47:09 GMT

My haplogroup is R1b, and my paternal ancestry is probably Scotch/Irish. Surname is Johnson. My DYS19 marker value is 16, which seems to be uncommon in this haplogroup -- most other R1b test as DYS19=13 or 14. I'm trying to understand the meaning of the DYS19=16. I've read that DYS19 has a slower-than-average mutation rate (a mutation every 667 generations), and that at least in haplogroup I1a it may indicate a Scandinavian ancestor. Might this have a similar meaning for haplogroup R1b? Can anyone give me more information or suggest where I might research this subject?

Fish DNA

mommycita — 26 Dec 2008 7:55:39 GMT

I've set up a FISH group under the DNA. Any of you with surname Fish (or derivatives) are welcome to post your DNA markers to see if match each other.

Juse click on DNA at the top of the page and choose Fish.

Aasland Y-DNA project

BillHarvey34 — 16 Dec 2008 6:38:52 GMT

Today (12/15/2008) I have established an Aasland/Ausland Y-DNA surname project via the services of Family Tree DNA (FTDNA).

Anyone interested in joining this Y-DNA project can find out particulars by contacting me at :
wlh_at_ foothill.net (replace the “_at_” with @ )

The project information can also be seen by going to : www.ftdna.com and inputting Aasland in the search box. This basic info will be supplemented with more background detail as time avails.

Any/All other Aasland/Ausland/Asland surnamed male participants from any geographic locale are welcome to join also. I hope to see many of you in time to come.

Feel free to contact me at the above e-mail address for any questions you may have.

William L (Bill) Harvey : Administrator for Aasland Y-DNA surname project at FTDNA
This is a purely volunteer effort with no payment or benefit derived from any source.

Getting DNA from buried family members?

seele01 — 12 Dec 2008 9:25:48 GMT

As morbid as it sounds, my family has no male relatives alive in order to try to sequence the paternal DNA. No male cousins, uncles, second cousins, or anything. I would (literally) have to go back at least 5 generations to unknown Finnish ancestors, and I currently have no clue if any of their male decendants are alive...

So it seems the best way would be to have bodies of my grandparents temporarily exumed, and DNA taken from them. Is this possible? Has anyone done this? Regarless of the morality and creepiness of it, would cemetaries honor the request? Can paternal DNA be gleemed from 60yo corpses?

While many might think it is strange, and above all, not worth it to do something drastic like this...there are some STRANGE questions as to the parentage of someone in my family, and which family member they truely decended from.
So yeah, thanks for the help, everyone.

Rob

Difference between Ancestry DNA and Family Tree DNA?

ShortTree — 20 Sep 2008 2:52:50 GMT

I am curious about the DNA testing that is offered on Ancestry and have also found Family Tree DNA.

1) What is the difference between the two test groups?

2) Do they share any information ... or are the results limited to the people that have specifically chosen their test?

Thanks,

Jeff

Crouch

ClaricePhillips75 — 7 Dec 2008 3:08:51 GMT

Is there a Crouch DNA project? If so, would you please e mail me at clarice@discover-net.net

Thank you..

DNA Family history test

Bex123456789 — 7 Dec 2008 5:51:43 GMT

Hello,

I am intending on buying my mum a DNA/Family History test. Her immediate family are from Germany/UK. Can anyone recommend the best test to purchase? There are so many and I am baffled. It would be great to know where the family routes come from and we have always suspected roots from India/Africa....

Thanks in advance.

Bex

Major update for Clan Donald DNA Project Website

ksaxe — 6 Dec 2008 8:59:23 GMT

The website for the DNA project for McDonald, MacDonald, McDaniel, McConnell, McDonnell, Donaldson, Donald, and other men whose male lines may be associated with the MacDonald Clan was updated during the holiday weekend. Many of the members of the project who were previously members of large “unclassified” groups within the project are now placed in smaller “classified” groups with men who are related to them. There are 3 new subgroups, an R1a Green group, an R1b Maroon group, and an R1b Yellow Green group, and other classified groups have expanded. The R1b Magenta group has grown to more than double its size in early November and includes a number of McDonald men.

You can see the tables here:

http://dna-project.clan-donald-usa.org/tables.htm

Immediately above some of the tables, there are new or revised notes on the groups in those tables. Some of these notes tell how the men were classified as members of particular groups. For some of the men added to the Magenta group, results for one of the markers in the 38-67 marker panels at FTDNA were critical in the decision-making process.

The note for the new R1b Yellow Green group states that the 464X test (a special test for the DYS464 markers) gives a distinctive results for members of that group. The Yellow Green group is part of a much larger group of related men, and most of those men would also receive a similarly distinctive result on the 464X test. I am working on a DNA project for the larger group, and I believe that some of the men who remain in the R1b Yellow Group of the project could be similarly grouped using 464X test results.

If you think that your family may fit into the larger group, you may contact me for more information, and you may want to visit our project website for the DYS464xccgg project:

http://www.familytreedna.com/public/DYS464x%20ccgg

I encourage all researchers with relatives in the Clan Donald DNA project to check out the revised tables AND the new network charts for the project. The network charts are a nice pictorial representation of the project data, showing a best approximation of a family tree for the men in the project. A chart including members of the R1b Magenta, Maroon, Yellow Green, and other groups may be found here:

http://dna-project.clan-donald-usa.org/R1b31treewrapper.htm

and another one using data for more markers may be found here:

http://dna-project.clan-donald-usa.org/R1b61treewrapper.htm

You can find links to charts for some of the other men in the project here:

http://dna-project.clan-donald-usa.org/DNAresults.htm

If no male from your family line is in the project, and you have a suitable male family member available for testing, you may want to take advantage of the holiday discounts available for orders placed through DNA projects. A suitable male would be any male whose all male line goes back to a man of the surname being researched. Usually, both the male testing and the ancestor would have the same surname, but there are exceptions when a name has changed.

For families with one member already in the project, it would make sense to encourage testing of more distant relatives and suspected relatives while these discounts are available.

If you have any questions relating to participation in the Clan Donald DNA project, I would be happy to answer them for you. Just reply to this message through the message board or e-mail me directly.

Kirsten Saxe, co-administrator for the DYS464xccgg project (and McConnell researcher)

DNA applied to Heraldry

MightyTree — 22 May 2006 4:19:20 GMT

Has there ever been a push to use DNA to prove descent from an armiger for a coat of arms? Are there any debates concerning this issue?

mtDNA test results

botoole9674 — 4 Dec 2008 10:17:35 GMT

I reviewed the results of my sister's mtDNA test. It reads:

Haplogroup H

Location Reference mtDNA Your mtDNA
263 A G
315.1 : C
16093 T Y
16304 T C

What does any of this mean?

FamilyTreeDNA offers Special Pricing

southard — 27 Nov 2008 12:25:14 GMT

Some of you are still considering whether or not to have a DNA test. Some of you tested 12 or 25 markers with FamilyTreeDNA and are part of the DOSS Surname Project, but wish you had done 37 or 67 markers. Now is the time to do that test or order an extension on one you have already done.

At this time of the year FamilyTreeDNA sometimes offers special prices on the tests, and these prices went into effect today. I found a statement about the special prices at the SOUTHARD DNA Project website. You can read it at
http://www.worldfamilies.net:80/surnames/southworth/

To be part of the DOSS Project and get these special prices, you will need to order the test through the DOSS project. If you want to order a new kit, you can do that by choosing from the drop-down menu at
https://www.familytreedna.com/surname_join.aspx?code=K28822&...
Apparently not all the tests are on sale, but the Y-DNA37 and Y-DNA67 tests are.

If you want to update to more markers, it isn't necessary to send another sample. At your personal website there is a link on the left side for ordering Tests and Upgrades.

The more of you DOSS or DAWS men who are tested, the faster our ancestors will be organized into family groupings.

Lura

What does DYS464c = 15.3 mean?

JohnMcX — 25 Nov 2008 1:36:16 GMT

What does DYS464c = 15.3 mean?
I have this result in my Ancestry Y-47 DNA testing. On Google, I've found that this is a value that pops up on occasion.
Does it literally mean that the string repeats 15.3 times, or does it have some other esoteric meaning?
I'm puzzled because neither ybase or ysearch seem to offer 15.3 as an input option. I've input 15 there but I wonder if that's wrong.
Any help appreciated.
jm

DNA PROJECTS ON JOLLY FAMILY MEMBERS

ANGELA4BELL — 20 Nov 2008 4:26:20 GMT

ARE THEIR ANY DNA PROJECTS, WILLING TO DO THIS PROJECT WITHOUT COST, WHO HAS THE MONEY. IS THEIR ANOTHER WAY?

Mackay DNA surname project

Bridget — 9 Oct 2004 12:44:57 GMT

I have begun a Mackay surname DNA project. (This will also include McKay, possibly McCoy, Makaay, Makaij and any other name that may have originally been Mackay.)

A surname project is designed to trace the members of a family sharing the same surname, so if you are a Mackay (or have a brother or cousin who is) please consider joining this study.

Please contact me if you have any questions or are interested in participating.

Bridget

FTDNA mtDNA Results

quinn86 — 17 Nov 2008 12:46:22 GMT

I wonder if anyone can help. Both my wife and myself have had our mitochondrial DNA done. Mine is J* and the match distribution is pretty well what you would expect, with matches from all over Europe but a very large number in England (172), Ireland (154), Scotland (104) and Germany (164). My wife is classified as H (Helena) and yet has very few matches. She has 5 in England, 4 in Scotland, 3 in Ireland. The highest is 9 in Finland. There is a similar picture on Mitosearch. As I understand it, from reading Brian Sykes book on the Saxons, Viking and Celts, H is a very common haplogroup in the British Isles amounting to around 50% of the population of each of the 4 countries. Why then are there so few matches while mine, Jasmine, which represents only about 10% of the Isles, has plenty of matches. One possible explanation is that the profile of mutations given by FTDNA is not actually just H but is H11 - some of the matches on FTDNA and on Mitosearch are H11, though most are just stated as H. Possibly this is a rarer subclade of H and therefore has fewer matches. The readings given are HVR1 - 16278T 16293G 16311C and HVR2 143A 195C 263G 315.1C

Can anyone shed any light on this?

As a subsidiary question FTDNA and Mitosearch give matches for mtDNA and their most distant female relative. It seems to me that this isn't much good unless my wife happened to have the same most distant female relative, which is very unlikely, especially if that relative is a long time ago (I mean 17th century or such like). What might be more useful for mtDNA (as opposed to Y-DNA where the name stays roughly the same) is if the poster gave all the female relatives in her line since the name changes every generation to a different male-derived name. To give an example my wife has a match with an American whose most distant rel was called Frei from Alsace Lorraine. My wife's grandmother was called Brimmer so I thought there might be a Germanic connection. Then I realized that my wife's g grandmother was called Schofield (a North England name) and her mother was called Ellen Allen (probably Scottish) and of course these were their fathers' names so goodness knows what the female name was back in the 17th century. So what good was this information to me? Am I missing a trick or is mtDNA just not as useful for finding families as Y-DNA, which is itself not very useful.

Y-DNA 37 Marker Match

GloriaKnight67 — 14 Nov 2008 2:56:58 GMT

Hello,
My husband D. KNIGHT had his Y-DNA done by FTDNA. We received notice that he has 3 37 marker matches with a surname BREWER. I have no paper trail as of now showing a connection with the above surname. I am not sure what direction to proceed. Should we go for the 67 marker test to further the results? Please advise for I am confused. I can only figure there is an illegitimate child, adopted child, etc.

Thanks,

Gloria Knight

Dill DNA

kristin_gessner — 13 Nov 2008 8:17:27 GMT

Has any other Dills taken a Y-DNA test? I have my uncle's results, and would like to compare with other Dills.

Thanks,
Kristin
kristin8881@Yahoo.com

Searching for my Grandfather

36gd8824 — 22 Jun 2008 2:48:10 GMT

My father was born out of wedlock in 1940 in Queensland Australia. He was adopted by my grandmother’s husband in 1943. I have no idea who his father was. I have obtained his birth certificate and have been told his fathers name is not listed on any government records. I have read some information about DNA testing and genealogy. I am wondering if anyone has any experience with the DNA process, and do they think I would get results from it. I have a brother and I have read that by testing his DNA I may be able to find my fathers family line.
Any advice would be appreciated.
regards
karen

Results in for Jeremiah O'Neal.

we6jbo2 — 1 Nov 2008 8:59:21 GMT

I just received my DNA results and have placed them here
http://download169.mediafire.com/u5ljsc9vq3lg/idnjmzndnzz/Je...

I'd be very interested in submitting the results to more databases so that I can gather more information.

comaring DNA results from Ancesty and Family Tree DNA

apresto4321 — 14 Oct 2008 1:41:41 GMT

I have a member of the Preston DNA Project who tested with FamilyTreeDNA. He has DNA markers from a man who tested at Ancestry. Other than uploading both results to YSearch or Ybase, is there any way to compare the results manually. He is looking for some way to compare the markers and see if he has a match.

Thanks in advance.

Angie Preston
Preston DNA Project

Y-DNA HAPLOGROUP I 1 B 2( Eye One Bee Two)

jrmcginn1 — 25 Sep 2008 4:25:25 GMT

Hi All
My haplogroup has changed over the past few years from I1C
to the above I suppose with refinement of knowledge etc.

I am a member of the McQueen Study Project managed by Scott Kendall, now part of Ancestry.

I am interested in encouraging all to join surname projects and I am particularly interested in McGinns and surname variants with Irish roots.
Rob McGinn, Ontario Canada

Brinkley DNA project

reneaq1 — 28 Oct 2008 9:10:04 GMT

I have started a Brinkley DNA project and welcome anyone who wants to share their DNA results for comparision.

Thankyou,

Renea

Pigg Family Project

wallacere12 — 21 Feb 2008 6:52:10 GMT

I am looking for interest in starting a Pigg family DNA group. Over time, many families have changed their surname, and as a result, family trees are quite a challenge. PThis family was one of the very early colonists in Virginia , with history in the US dating back to the 1600's.lease respond to this thread if you or your kin are interested.

New DNA Project Amy-Amigh-Emigh, etc. started

FredricZS — 26 Aug 2008 3:12:14 GMT

A new surname project has been established with FTDNA and World Families for the surnames Amy, Amey, Amigh, Amick, Amich, Emigh, Emig, Emick, Emich, Eighmy, Eighmey. To test, you must be a male descendant of one of those families (or any other similar surname). FTDNA has some great price discounts through 31 Aug. 2008, so now is a good time to test.
http://www.familytreedna.com/surname_join.aspx?code=Q13000&a...

If you have any questions about the project, please contact me.

Rick Saunders
Amy-Amigh-Emigh DNA project coordinator

My full sequence mtDNA Haplogroup B2 results

Ernie_Alderete — 9 Feb 2008 9:00:56 GMT

I recently received my full sequence mtDNA results from Family Tree. I'd appreciate any feedback. I'm particularly interested in medical indicators as well as tribal connections.

750G
827G
1438G
2706G
3547G
4180G
4769G
4820A
4977C
6473T
7028T
8281-
8282-
8283-
8284-
8285-
8286-
8287-
8288-
8289-
8348G
8860G
9097G
9950C
11177T
11719A
13035T
13590A
14766T
15326G
15535T

My mtDNA:

HVR1 Haplogroup B
HVR1 differences
from CRS

16183C
16189C
16217C
16483A
16519C

HVR2 differences
from CRS
73G
263G
309.1C
309.2C
315.1C
499A

Thank you for your interest:)

There’s a new project at Family Tree devoted to mtDNA Haplogroup B2.
B2 is one of the four major matrilineal Native American lineages.
And the only one that stretches across the Pacific Ocean to embrace Polynesia and areas as far a field as Madagascar.

I have created this project because I have found so little research on this fascinating lineage. Today there are more questions than answers.
Just what is the connection between the peoples of the Americas and that of Oceania? Was America peopled from Southeast Asia via the Pacific Isles?

Someday this incredible journey maybe fully documented, and understood. This project is one humble step in that direction. A shout at the Eurocentric Genetic establishment, that we’re not white, but we matter, we want our ancestry researched, too.

I’ve written to journals and asked them to write investigative articles on this important lineage, but have not received responses.
If you’re mtDNA Haplogroup B2 I invite you to add your test results to this new project. Let the Ivy League geneticists in their ivory towers know we are here, we care, we spend, we are a force to be reckoned with. Ignore B2 at your own peril!

http://www.familytreedna.com/surname_join.aspx?code=A92491

My maternal (Rodriguez, Contreras, Montoya, Acosta, Porras, Vasquez, Serecedes, Cobos, Corral, Olguin, Gallardo, Robeldo, Najera, Suares, Caballero, Gutierrez, Caro, Aranda) home page:

http://www.genealogy.com/users/a/l/d/Ernie-Alderete-Monterey...

My paternal (Romo, Ramirez, Gonzales, Ybarra, Rodriguez, Veles, Rangel, Moctezuma) homepage:

http://www.genealogy.com/users/a/l/d/Ernie-Alderete/

My Moctezuma DNA Project:
http://www.familytreedna.com/public/moctezuma

My Alderete DNA Project:
http://www.familytreedna.com/(hcojjivgekjvu155hef2gy55)/publ...

JOHNSTON/E Y-DNA Testing Request

Cliff. Johnston — 29 Dec 2005 10:12:31 GMT

The Johnston/e families which farmed to the north and west of Crysler in Finch Twp., in the mid- to late 1800's were said to be related to our Johnston families which farmed to the north of Pendleton in Prescott Co.. In the mid-1880's there were two marriages between the Johnstons and the Johnstones: our William Johnston (son of Robert "Red Robin" Johnston) married Sarah Johnstone, and Abe Johnstone married Susan Johnston (daughter of Archibald Johnston).

I recently had my Y-DNA tested. It came back identified as I1c haplogroup which caught us by surprise. Most Johnston/es were testing as R1b, Celtic descent. Our ancestry is Danish Viking - a big difference. I had come upon some oral family history over the years which indicated that our Johnston family was "different" from most other Johnston/e families, but there was never an explanation attached to the "different". This could very well explain the difference. Interesting too was a recently discovered photograph ca. 1874 which had our family name written on the reverse as "Johnstone".

I am looking for male descendants of the Johnston/es of Crysler who are interested in having their Y-DNA tested. This link shows a map of their farms ca. 1879: http://www.pbase.com/image/50464996/large Oral family history indicates that our Prescott Co. Johnstons were related to the Stormont Co. Johnston/es, but I and others have not been able to find any documentation that would confirm such a relationship. If you are interested, please, contact me and we'll take it from there.

Good hunting,

Cliff. Johnston
Granbury, TX

Silk Road yDNA

TimeTrax — 3 Jan 2009 2:17:08 GMT

The search is for those individuals whose male ancestors were on the Silk Road -- as explained, this is being done via a specific proven Silk Road Modal, in conjunction with a known family line which began with an orphan in 1639 -- thus current family surnames are not a restruction (his was bestowed/invented)

I drew his attention to the data established as the common Modal
DSY19/DSY388/DSY390/DSY391/DSY392/DSY393/

My yDNA modal is the 17-12-24-11-11-13, which and researching is what has gotten me involved. This should be the MODAL of Jeremias Shrecongast and most Schreck varient surnames in the United States.

If your line has males who can be tested, It is something worth proving. As explained below, it would appear that all those who are of this line have a possible tie back to the Lost Tribes of Israel -- specifically the tribes of Zebulun and Issachar.

I know there are those who will scarf at this, but there is hard evidence to establish we are all along the Silk Road which was founded by the Jews of the fifth century BCE. I, for one, want to confirm this association to whatever degree is possible -- if only because there is clear evidence that my yDNA was there -- thus an ancestor, and the children of that ancestor, was there. We have their bodies. Now the question is: Who else is of this line.

____________________________________________________________

As Dr Donon M. Behar is engaged in the study of Ashkenazi-Levites, I thought I would bring something to his attention – which indicates the Ashkenazi were part of the Diaspora of 588 BCE.

I use as references these papers – his being the first on the list::
1. Multiple Origins of Ashkenazi Levites: Y Chromosome Evidence for Both Near Eastern and European Ancestries.

2. Nuclear and Mitochondrial DNA Analysis of a 2,000-Year-Old Necropolis in the Egyin Gol Valley of Mongolia – by: Christine Keyser-Tracqui, Eric Crubezy, and Bertrand Ludes

3. The Y Chromosome Pool of Jews as Part of the Genetic Landscape of the Middle East – by: Almut Nebel, Dvora Filon, Bernd Brinkmann, Partha P. Majumder, Marina Faerman,
and Ariella Oppenheim

4. The Genetic Heritage of the Earliest Settlers Persists Both in Indian Tribal – by T. Kivisild, S. Rootsi, M. Metspalu, S. Mastana, K. Kaldma, J. Parik, 1 E. Metspalu, M. Adojaan, H.-V. Tolk, V. Stepanov, M. Golge, E. Usanga, S. S. Papiha, C. Cinniog¢lu, R. King, L. Cavalli-Sforza, P. A. Underhill, and R. Villems

5. Negligible Male Gene Flow Across Ethnic Boundaries in India, Revealed by Analysis of Y-Chromosomal DNA Polymorphisms – by: Majumder Nitai Pada Bhattacharyya, Priyadarshi Basu, Madhusudan Das, Srimanta Pramanik, Rajat Banerjee, Bidyut Roy, Susanta Roychoudhury and Partha P. Majumder

Not the occurrence of my Modal and, more importantly, the Modal 16-12-25-11-11-13, and the one mutation 16-12-24-11-11-13. I have not yet checked the Indian lists for the 15-12-24-10-11-13 but suspect he would find it is also prevalent.

The second paper states “This burial site is linked to the Xiongnu period and was used from the 3rd century B.C. to the 2nd century A.D.” As such the Modal there clearly predates assertions of conversion – concurrent with, or post, Khazar – as the basis for, or origin point of, the Ashkenazi.

By my calculation fifty-two (52%) percent of the Gol Valley graves – with sufficient yDNA for analysis and comparison – were Ashkenazi; but this is 800 year prior to the Ashkenazi appearance.

We know that the second diaspora is concurrent with the assumed beginnings of the Jewish presence on, or establishment of, the Silk Road to China. The Modals (both mine and the 6-12-25-11-11-13) establish that these were the families who journeyed that road. The appearance of both these Modals in the Brahmin population also infers an influence in the creation, or beginning, of that Caste and possibly the associated religion.

The Nebel et al paper (third paper) provided a racing/cultural/geographic connection for each Modal – all are within biblical territories associated with the Tribes of Zebulun and Issachar (also Naphtali, Asher & Dan, but I’ll focus on the tribes noted for Torah study.)

My belief is that there was a Biblical era admix with R1a Modals through the Phoenician, or Sea Peoples, and this was represented in the commerce by land and sea associated with the Canaanite region.

The Diaspora saw these people moved to Turkey, where some crossed the Caucasus Mountains into the area Herodotus identifies as Colchis. Going one step further, I suggest the North Africa association found in the Gol data is “Egyptian” as described by Herodotus in Book 2 – where he says the people of Colchis practice circumcision and resemble Egyptians (or Ethiopians) who also practice it (Noting that Herodotus makes no mention of an Israelite practice in 440 BCE).

Obviously, his work already establishes a Near Eastern yDNA origin. I requested he provide any further evidence to support this hypothesis – that the Ashkenazi might be the remnant of the original Tribes from the area of Galilee. I would also like any confirmation that my Modal appears in ancient sites in Judah/Israel.

___________________________________________________________________________________

For reasons not relevant here, my "alledged" neice, Christina Lynn Schreck, is noted for disavowing my connection to her line. I disavowal which I will wilcome if it means her line is not from Jeremias and does not share this rich association and conection to history. Anyone in the line can get a free DNA test from SMGF.org -- it will only provide 12 markers, but that is sufficient to prove a connection to this historic line -- and to pave the way for a genealogy that is documented to 2,600 years.

Getting the test yields a connection which no "paper trail" genealogist can prove -- one which, from the papers cited (and other) is being worked on (LOL ... for free ...LOL) by some of the best medical minds in the field of Population Genetics.

Origins of I2B1

swbtmis — 15 Oct 2008 4:37:06 GMT

I am creating FLUXUS charts using the alleles shown in the below web site
http://www.familytreedna.com/public/M223-Y-Clan

the problem is there are so many members that the data is a big mess when it charts. what I am trying to do is to find out if there is anyway to segregate all the members into groups by country of origin. at least even by guess.
I read a lot about M223, M284, S21 etc. BUT I dont know how to use the alleles to know if a person is a M284 etc.

Permanent lower prices at FTDNA

NancyKiser — 13 Oct 2008 9:52:27 GMT

Hello, everyone,

I recently discovered that Family Tree DNA has permanently lowered the prices of their 25, 37 and 67 marker Y-DNA tests. These are the male DNA tests and the tests must be ordered through a group project to obtain these prices. Here are the current group prices:

25 marker Y-DNA test: $124 plus $4 postage
37 marker Y-DNA test: $149 plus $4 postage
67 marker Y-DNA test: $248 plus $4 postage

This means the 37 marker test now costs approximately the same as the 25 marker test used to cost. In my opinion, the 37 marker test is the best test for your money, and the 67 marker test is unnecessary, except in certain circumstances. I am a volunteer administrator of several DNA projects hosted by Family Tree DNA.

Sincerely,
Nancy Kiser

Does ancestry.com DNA have a surname project list?

nwsidechicago — 23 Jul 2008 2:55:48 GMT

My husband is an Upton and trying to decide which DNA testing company to use. I just noticed Ancestry.com is having a sale. I was wondering if ancestry.com has a surname list of people that have used their service and is now listed on there.
We are very new to the DNA thing, and understand the basic stuff like male to male and that your name is entired into a surname list with other Uptons that matched your DNA, I guess.
I did see a project on a yahoo search that has Uptons, but you have to be from that state, or know one of your known ancestors have to be from there, seems strange to me.

OLIVER DNA Group

chaye61 — 13 Oct 2008 2:24:41 GMT

I have started an OLIVER DNA group on ancestry.com
It would be great if all you Olivers out there who have DNA results could register. Lets see what we can find out by comparing our DNA results. For those of you who haven't done this before here are the instructions -

Go to dna.ancestry.com
Select "Browse All Groups"
Choose "O"
Scroll to find the Oliver group
Click on "Oliver"
Request membership.

Looking forward to making exciting new discoveries and breakthroughs with you.

Chaye Oliver
australia

DNA Y chromosome

castanea1985 — 10 Oct 2008 8:51:49 GMT

If you have a match of approx 3 generations. How likely is it that the nearest common ancestor is actually 3 generations, when they say it is only 50%??

Haplogroup I1a-Stonemans

peggydalton58 — 25 Aug 2008 5:01:27 GMT

I received my fathers DNA under the Dalton DNA progect thru ancestry.com.. When I looked at the others, his numbers really didn't match up to others close enough to say they are related.He was illegitamate, so I do not know if his last name should fall under this project.
Is there anyway of taking his numbers and matching them up to other projects?
He was told his birth father was Frank Dalton and that is what it shows on his birth record.Dad is almost 86 years old.

Adda Tinemuth Cyphert (Haight), Orcelia/Orcella Ann Horton

thaiguybaker — 12 Jun 2005 7:19:05 GMT

Adda Tinemuth, born 16 August 1874 in Brookville, Jefferson, PA; died 18 August 1952; married Anson Wesley Haight 24 December 1892. Most likely of Native American descent (Seneca?). Her mother was Orcella/Orcellia Ann Horton, born February 1858?; daughter of Squire Henry Horton and Jude Youmans, Jefferson Co., Rose township, PA. I am descended in a straight maternal line from her. Is anyone interested in a DNA project (including testing services) to ascertain Native American lineage and any other possible information?

Guy

Link to Fant/Faunt/Font

kathlingram — 7 Oct 2008 4:42:09 GMT

In the last 2 weeks we have added 2 Fant or Font men to our database of men who match both the Stafford County Fants who are in US possibly in 1674 and the Fethard Tipperary Faunts who are come-latelys in 1869.
One new man matches the former and a 2nd man traces his ancestry back to Liverpool and possibly Ireland before 1800.

Here is a link to the ancestry.com group that has been formed..it is as guest..when you get there if you wish you can click to Join.
http://groups.ancestry.com/signup/respond.aspx?invid=Y2RTO8w...

Kathleen Carrow Ingram Group Admin ( Grandpop was a Faunt from Tipperary)

Cousin Links?

jostorie — 5 Oct 2008 10:04:39 GMT

I'm not sure if this is where I can get an answer to a question but here goes.
My husband has a great-grandmother (Smith, ugh!) in Kentucky whose parentage is unknown. I believe I know who her sistr was and I know who that ?sister's parents were and I've found a descendent(female) of the supposed sister. But I cannot prove the sisters? to be sisters.
I'm wondering if a dna test from my husband and dna from the female hopeful cousin could prove a family connection? And how close the dna test would prove connection?

Thanks

Hewitt/Hewett genealogy

dmoneta — 12 Mar 2008 3:23:31 GMT

Dear Hewitt/Hewett/Huot Researchers and other versions of the name,

We are a group of people working on our ancestry who have formed a DNA project to help us with our researching. Genetic genealogy is an exciting field that combines the science of DNA testing with the time honored methods of traditional paper trail research. Our group is still rather small, we have sixteen participants, but we have a vast variety of Hewitt and variant lines from many places in the world, including England, Ireland, France, Canada, Australia, and the United States.

One of our participants descends from a long line of Hewetts who immigrated to the Jamestown, Virginia in the early 1600s from Kent, England. Richard Hewitt of this line died in Jamestown in 1622. Family tradition says that he was survived by two sons who went on to produce many descendants that settled in the southeastern part of North Carolina, around Wilmington. The wife of one descendant, James Hewett, born 1721, was Susannah Crump, great-granddaughter of Rev. Richard Buck who married John Rolfe to Pocahontas.

Other participants have stories such as Captain Thomas Hewitt, born in 1630 who resided in Connecticut and died at sea in 1666 and Randall Hewitt born in London and immigrated to New York and died in Cape May, New Jersey. His line settled in Brunswick County, North Carolina.

Descendants of Lacey Hewitt, born about 1815 in East Ruston, Norfolk, England still live in England. Some Hewitts participants descend from families that originated in Ireland, such as Hamilton Hewitt born 1790 in county Cork and Adam Hewitt born 1770 in county Down. Adam immigrated to New Brunswick, Canada as did Mathurin Huot from France who settled in Quebec. One of our participants descends from Edward Hewitt born in 1773 Bishopstone, Wilshire, England; descendants now reside in Australia.

William Joseph Hewitt was born in 1832 in Surrey, England; he immigrated to Bureau County, Illinois as a young man and fought in the American Civil War. He and his wife settled in Nodaway County, Missouri where they raised a large family.

We would like to extend an invitation to anyone who carries the Hewitt/Hewett/Huot or any variation of the name to join our DNA project. The more participants we have the better chance to make connections. Even it you do not have much information about your ancestry, you may be able to match up genetically with someone who does. If you would like to read more about our project, please visit our website at www.familytreedna.com/public/Hewitt.

My name is Daniela Moneta and I am the great-great-granddaughter of William Hewitt who fought in the Civil War. I am the volunteer project coordinator for the Hewitt DNA project. This is a Y-Chromosome DNA study so if you are female, like me (we have X-Chromosomes), you will have to ask a brother, father, or male cousin to test for you. If you have any questions about our project or have questions about DNA testing, I would be happy to answer them.

Sincerely,
Daniela

Thurrott DNA

Bennett3820 — 16 Feb 2008 8:40:22 GMT

Hi,
I am a descendant of John Thurrott and Mary Morton. I would like to know more about the deeper Thurrott roots and think that DNA may help with that. Are there any Thurrott descendants who would be interested in having a DNA test done? You must be the son of a son of a son etc. of James or John Thurrott to have a Y DNA test to indentify Thurrott DNA.

Discounts on DNA test extended

NancyKiser — 29 Aug 2008 11:57:51 GMT

Hello, everyone,

Just wanted to let you know that Family Tree DNA decided to expand and extend their promotion on DNA tests to the end of September. Here are the tests that are on sale:

Y-DNA 12 marker test plus free mtDNA test: $99
Y-DNA 25 marker test plus free mtDNA test: $148
Y-DNA 37 marker test: $119
Y-DNA 37 marker test plus free mtDNA test: $189
Y-DNA 67 marker test: $218
Y-DNA 67 marker test plus free mtDNA test: $288
MtDNAplus test: $149

If anyone out there has been considering getting their DNA tested, this would be an excellent time to do it. These are group rates so you MUST order your test through a group project and you must pay by credit card or your check must be received by September 30, 2008. If you happen to be a Phillips, here is a link to my Phillips DNA project where you can order a test at the reduced rates: https://www.familytreedna.com/surname_join.aspx?code=A77632&...

Nancy Kiser
Administrator
Phillips DNA Project

MAYNARD/MAYNOR/Variants DNA Project Started

Anne W. Nelson — 12 Sep 2003 3:53:29 GMT

I have started a DNA Project to see which of these surnames might be related, and also to help sort out the various lines. There are basically two kinds of DNA tests:
1. Y-Chromosome: requires an ALL MALE line of descent for donor
2. mtDNA: donor may be male or female but it must pass through mother>mother's mother>mother's mother's mother> so on.
There are NO comparisons between a Y-chromosome test and an mtDNA.

Interested parties may email me for further details. I am a MAYNOR researcher in NC/SC/GA/AL.

Clueless newbie so confused! FamilyTreeDNA and GenographicProject results

tmdupree — 15 Sep 2008 2:27:43 GMT

I'm sorry if this has been asked already, but I've searched the help and this board and been unable to find an answer.

Is there any type of a tutorial for DNA newbies on how to enter your results into Ancestry.com? I have my results from the Genographic Project as well as Family Tree DNA, but I'm baffled as to how to enter them.

My Genographic Project result code looks like this:
16261T, 16298C, 16311C, 16519C

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAG
CAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAG
CCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTCAACAGTAC
ATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
TCACGATG

Do I just ignore the long line of code, and enter in the:

16261T, 16298C, 16311C, 16519C

If so, do I add the letter in, or use the drop down for the letter code?

Also I tried entering in my FamilyTreeDNA results and got nothing but errors. Is there any guide or how-to for clueless newbies?

Thank you

rare blood donor card-haplotype?

nekocat — 8 Sep 2008 5:08:57 GMT

in front of me is my husband's rare blood donor card. he's type 0+, but after that is R1R1, the 1's being brought down half a line. he's a Moore, which tends mostly to be haplotype R1b1.
my question, is R1R1 his haplotype? or does that designate something else and just look like a haplotype?
I just sent for his Moore dna kit, and I've traced his Moore's back to 1810 Beaver Co., PA, but I've been checking things while we wait for the kit to arrive and this has me curious.
thank you for any information that will help clear this up.

DNA Results with Genetic Percentage

hinklerj — 8 Jun 2008 1:22:07 GMT

I am hoping maybe someone may be able to help in this question. I have been doing a lot of research on DNA and have participated in several tests. One through The National Geographic Project (Haplogroup H)and then had test done for a percentage of genetic ancestry. The percentile results from the genetic ancestry produced an 88 percent European genealogy, which was no surprise. I have found my family history (paternal and maternal) going back to Europe (German, England, Scotland, Ireland). But then the other percentage came up with 12 percent Native American. I have never found any link to Native American through my genealogy. From what I can understand, at 12 percent (it did provide a range of 4 to 20 percent) would mean that my mother or father would have to have been 25 percent. With that my Grand Father or Grand Mother would have had to have been around 50 percent and so on. There is nothing I can find that would point to any of them having Native American. Is there another possible explanation for this percentage or another way that it would have come up so high? There may have been some from farther back as I have been unable to complete some of my tree due to lack of information. My parents and grand parents passed away long ago and my immediate family seemed to have no information. Any suggestions or insight from anyone would be helpful.

Outlaw Ancestry DNA Website

hypnobambie — 30 May 2008 5:19:35 GMT

I am a descendent of an outlaw and know others who are putting together our histories, genealogy and DNA.

We are establishing a web page to gather descendents together and share who our information and DNA which will clear up some interesting stories, and no doubt open up others...

Is anyone interested in more information and joinging our group?

I don't know the surname! :(

ricknlida — 29 Aug 2008 11:09:13 GMT

I have dna results from a family group that we don't know the surname for. It's a long story...

Are there websites where we can search the dna results to find surnames that have matches or close matches?

Thanks!

STANALAND and spelling variation DNA project, participating on STANLEY project

AWStanaland — 30 Aug 2008 12:38:37 GMT

Does your surname share the same genealogy as people bearing the surname STANALAND and all of its spelling variations? DNA testing may help us discover the answer.

My husband was born STANALAND on a line that descends from Hugh STANALAND and Sarah OGDEN ...on a line of STANALANDs with many STANLEYs and variations of STANALAND because the surname was passed along with a variety of spellings. I have read the genealogy research on the line which had 3 known British born immigrants to America in the late 1600s to early 1700s ...Hugh, John and Thomas ..and I have many questions.

Certainly there are surnames that are 'pure' and did not change, but quite often that is not the case. For instance, is STANLEY, STANGELAND, STANGLAND, STENLUND, etc a Scandinavian variation of the STANALAND, etc. surname that has been tracked to the British Isles? Maybe, but DNA is likely the only way to know our deeper, more distant roots and connections.

All the spelling variations of the STANALAND surname may now participate in the STANLEY DNA project on FTDNA.

The administrators of the STANLEY project agreed to add a variety of surnames on the STANALAND / STANLEY family lines to their already organized group project.

In the book "STANALANDs of the U.S." compiled by Schuler D. STANALAND, there are dozens of STANLEYs and several variations of the name STANALAND name that are all part of the same family line and that should share DNA.

If you have a surname spelled
Stanaland, STANLAND, Staniland, Stanoland, STANGLAND, Stangeland, Stanley, STANLY, Standley, Standly, STENLUND, Stanlan or Stanalan, Stanilan....you may learn more about your genealogy than has been so far published, simply by connecting with people who share your DNA.

DNA for genealogical purposes is never a substitute for traditional research to find a paper trail, but DNA often reveals more than you can imagine and often connects you with other people who have enough genealogy on their line to bridge some gaps ...or to offer new clues to your history.

The STANALAND line has some good data accumulated an published in Schuler D. STANALANDs book, as well as a book compiled by Dorothy STANALAND SAMUEL "The Desdendants of Hugh STANALAND, an early settler of Pike County, Alabama ...which covers the descendants of my husband's line. In spite of the genealogy history collected in these publications, there is much we do not know ..and plenty fo room to learn more.

So the answer to 'why participate in a DNA project?' is that we need to work to correct some errors in some of the data and family lore ...

...and we can expand our knowledge and seek some answers for our American, Australia, etc. immigrants across the ocean in the British Isles, and possibly Scandinavia who might be the root ancestors on our common lines.

DNA will give us new answers ...but WE NEED male surname bearing CANDIDATES for the DNA project, which involves only simple mouth swabs that are put in vials and returned to the lab.

Please reply here ...or contact me (connect the spaces) at audstan @ chartertn.net for more information.

Audrey in TN

Any Jewish DNA Connection With Northern Cherokee ?

jadiwa48 — 22 Aug 2008 10:27:39 GMT

I am interested in hearing from anyone that has knowledge of a Jewish (particularly Ashkenazi) connection to the Northern Cherokee. Some of my paternal g-g-grandparents were part Northern Cherokee Indian.

Because of a gene mutation that has recently been discovered in my family, I am looking into the possibility that my family line has a Jewish connection.

The gene is BRCA2, which is a gene mutation for breast and ovarian cancer, as well as other cancers including melanoma and prostate cancer.

If anyone has any information on this subject, I'd appreciate it.

Thank you.

Preston DNA Project

apresto4321 — 20 Aug 2008 6:38:32 GMT

Hello!

The Preston DNA Project now has 21 members. We have several matches at the project, but would like to see more. The more participants that we have in the Project, the more useful the database.

Family Tree DNA is having a sale now through the end of August 2008 for new members. You must join a Project to get the group rates. The YDNA 37 marker test has been reduced to $119 during this sale.

To find out more information on DNA Testing and the Preston DNA Project, please follow this link:

http://www.worldfamilies.net/surnames/preston

Click on the tabs at the top of the page to see the individual pages of the Project.

On a personal note, the Kentucky River Prestons are seeking their ancestors. We believe they were in Virginia before coming to Kentucky in the late 1700s. This has been our dead end for many, many years. Our hopes are to make a connection to a Preston line in Virginia or elsewhere through DNA Testing.

Best Regards,

Angie Preston

is there a

KLoyd41 — 16 Aug 2008 4:07:01 GMT

is there a Losey DNA project on Ancestry?

Discounts on DNA tests at FTDNA

NancyKiser — 16 Aug 2008 3:56:50 GMT

Hello, everyone,

I wanted to let you know that Family Tree DNA is offering some promotions on their DNA tests until the end of the month (August 31, 2008). Here is their announcement:

Y-DNA12 orders include a FREE mtDNA test (Y-DNA12+mtDNA promotion price of $99; normally $189)

Y-DNA25 orders include a FREE mtDNA test (Y-DNA25+mtDNA promotion price of $148; normally $238)

Y-DNA37 orders price REDUCED to $119 (normally $189)

Y-DNA37+mtDNAPlus orders price REDUCED to $189 (normally $339)

Y-DNA67+mtDNAPlus orders price REDUCED to $288 (normally $409)

mtDNAPlus price REDUCED to $149 (normally $189)

Since mtDNA (maternal) DNA tests are not very useful for genealogical purposes, I think the reduced price on the 37 marker yDNA test for men is the best deal. You MUST order your test through a DNA project in order to obtain these prices. These are group rates.

Also, I wanted to announce that I have started my own Phillips DNA Project hosted by Family Tree DNA. If you are a male Phillips and are interested in getting your yDNA tested and analyzed, please contact me at nancy2kiser@yahoo.com.

Sincerely,
Nancy Kiser

dna

KLoyd41 — 16 Aug 2008 3:51:13 GMT

which DNA test is best

DNA questions

faith196238 — 12 Sep 2005 1:49:24 GMT

I guess I'm not fully understanding the DNA project. Would someone explain it as simply as possible. I keep doing the reading but I'm confused as to what test should be done, where the results are located, how do you submit it to genealogy to find matches?
Thanks for any help.

DNA Testing

beshiresjim — 13 Aug 2008 8:30:16 GMT

I recently saw an ad in one of the genealogy magazines from a company called DNA Testings Systems, located in Scotsdale, Az. I went to their website and looked at the different types of tests that they offered and ordered the one they recommended - cost $295.00.
After sending the test swab off, I anxiously awaited the results. In less than two weeks I received a pdf file with their proported results.
They ran 13 markers and came up with my top 20 supposedly matches. Match #1 was Black Ecquadorian, Match #2 was Han Chinese, and the other matches were all Hispanic. I am a white Caucasian male and have traced my lines back to the 15th century and all my ancestors were European. No Ecquadorian nor Chinese, nor Hispanic.
Not the less to say that I was extremely disappointed and e-mailed them with that disappointment. Their reply was that their test was not supposed to give you a DNA match, just general information about your distant ancestors!
This company is a total rip-off and I'd advise anyone looking for a DNA test to avoid them like the plague.

DNA Testing

dispb4 — 12 Aug 2008 4:08:05 GMT

OK, maybe someone can help...
I would like to do a DNA testing...and understand being female there is only one test..But my question/problem is...
I am the youngest of 6..
The first 3 kids are from 1st marraige...all girls
the next 2 from common law live in...boy and girl
me from an affair...dont know who he was...
now I have one brother by another man than my father.
but I do have numerous nephews...could one of them take the test for me...
I want to know before I spend monies and find out cannot do test...Please let me know, greatly appreciated

Cathy
kiki@warwick.net

Nutt DNA project

MarciaMcClure — 12 Aug 2008 10:17:40 GMT

I am working on several families who have very active DNA projects. We need one on the Nutt and similar surnames! The information garnered is incredibly valuable.

Are we all related? Doubtful, but you could stop chasing dead ends. You would be able to concentrate on lines that share your markers and help identify a common male ancestor.

The test is simple. It's just a cheek swab... some spit. Ancestry is running a special through September.
http://dna.ancestry.com/selectTest.aspx;jsessionid=7456BBE0D...?

We need men with the Nutt surname to participate. What is tested are the markers passed from father to son over the generations. This will not tell you anything about the maternal line of your family. Certain markers mutate faster than others, but what we end up with are familial groups who at some point share a common ancestor. You are able to use your matches and their lineages as clues to where to look for your own family. Maybe even more valuable, you learn who you are not related to.

I would be glad to head up the project for the time being, but if someone with web experience and some free time wants to take over, that would be great.

A couple examples of how this has helped my research:

My Pearce/Pierce line. We have several matches and an idea of where our family is from. We are not related to families of the same name who appear in the same counties as we do in NC and TN. I have wasted countless hours trying to figure out how we tie together. No wonder I couldn't because we don't.

My Speer line - and many of you southern Nutts are related to the Speer and Steelman family. Andrew Speer was the original ancestor in Somerset, MD c 1666. There are no other matching lines of Speer/Spear/Speers/Spears, other than Andrew's descendants, in this country until the late 1800's when some come from Ireland. There are some who come from Germany, etc - but they don't match our markers.

Our "Irish" Speer cousins trace their lineage to the Orkney Islands north of Scotland. Our DNA tells us that we are the descendants of Scandinavians, probably Vikings.

Please consider participating! It will give you a specific group that you can exchange information with and research together.

DNA Group-Ancestry.com

DKBeachgenealogy — 8 Dec 2008 2:41:36 GMT

I have begun a new BEACH group at Ancestry.com. This came about due to the growing number of BEACH family members participating in the Ancestry DNA Project.

For those interested in DNA testing Ancestry is offering a special this month to those with a membership. The cost is very good and would assist in our search for additional BEACHes to become participants in a DNA Project.

Those who have tested with FTDNA can manually add their results to Ancestry's data base. If you do, please join the BEACH group.

The Ancestry group has many options available besides DNA comparisons, I would like to invite all BEACHes to join this group and work together in an effort to assist in research of our lineage and add current personal information, such a pictures and a variety of other information. Please, check out our site. To locate our group, access Ancestries home page, click on DNA, then enter BEACH in "Search for Groups" box.

If you have any questions, you can contact me directly at DKBeachFam@aol.com.

Best regards, Denis

WEBB DNA PROJECT STARTED! Please read

Anne W. Nelson — 12 Aug 2008 11:43:49 GMT

Some cousins and I have decided to try to broach our brick wall using DNA analysis. This requires all male lines (ie father -son-grandson-greatgrandson all WEBB). This is a painless self-administered, mail in cheek swab. It can also give ethnic background (English, Irish, Welsh, etc)

My line is stuck in Jefferson Co, GA in the late 1700s, but probably came from NC before the Revolution and VA before that. Descendants went on to AL, MS, TX, and the family may have been in SC for awhile..

The following less common names appear in our line/group and may appear in related lines:
Elias, Stephen, Rice, Brittain/Britton, Matilda, Caroline, Catherine, Milly, Lydia, Brinson, Dicey, Jesse, Samuel.

Related Families: MAYNOR/MANER, RUFFIN, HOLT, DUNN, STRICKLAND, ROBERTS(ON), PATTERSON, BOZEMAN

The costs are reduced when we submit a minimum of 6 samples as a Group. I am serving as the Group Administrator for this study.

If you are stuck on your line, this may help you break through your brick wall. If you have a documented line, this study needs your samples to compare our results TO. Please contact me if you are willing to participate.

I will post regular updates on the progress of the study to the WEBB mailing list on rootsweb and to Genforum and here.

Thank you!

WEBB DNA PROJECT STARTED! Please read

Anne W. Nelson — 12 Aug 2008 11:43:49 GMT

<thread><path>..fh.topics.dnaresearch.projectannouncements</path><threadid>1864</threadid></thread>

Hello Bianchi!

RobynGiana — 6 Aug 2008 3:00:50 GMT

Hello Bianchi!

If you are a male with the last name Bianchi, please participate in the Bianchi DNA project on Ancestry.com!

The price is half off!

Let me know if you have any questions!
RobynGiana@gmail.com

Jewish DNA among Southeastern Indians

strawdog_1 — 11 Apr 2004 1:44:39 GMT

Changes to website at Phillips Worldwide DNA Project

NancyKiser — 30 Jul 2008 5:21:53 GMT

Hello, everyone,

This is Nancy Kiser, the administrator of the Phillips Worldwide DNA Project. As some of you have noticed, World Families decided to make some changes to their website last week. One of the changes involved giving us a new URL, which is now http://www.worldfamilies.net/surnames/phillips. The old address, which is http://www.worldfamilies.net/surnames/p/phillips, is also supposed to still work, but half the time it does not.

When World Families made the changes, the Patriarchs Page got all scrambled up. I have tried to fix it, but I continue to find errors that were introduced by the changes. If your Phillips pedigree is posted on the Patriarchs Page, please go to the Patriarchs Page and make sure your pedigree is correct and is linked with the correct kit number and the correct family group, if applicable.

When World Families made the changes, our Singles Y-DNA chart was permanently deleted. However, there is now more room on the Y-Results page, so I am now able to upload both the Family Groups and the Singletons all on one page, and I have done that.

The navigation for our website at World Families is still located at the top of the page in the gray bar. Just click on whichever page you want to read. Above the gray bar is a black bar that allows you to navigate directly to the different general pages at World Families.

If you have any questions about all this, or if you cannot find your results on the Patriarchs Page or the Y-Results Page, please let me know. I apologize for the inconvenience.

Sincerely,
Nancy Kiser

Half Price DNA testing via Ancestry.com

perl47 — 26 Jul 2008 2:34:55 GMT

Ancestry.com is reducing the price of the Y-DNA tests by 50% until Sept. 30.

The best way to sort out our Phillips ancestry is for males named Phillips to be tested and now is the perfect opportunity.

It's very simple to do the test. The company will send the test kit to your house, you swab the inside of your cheek with the Q-tip type thing they send you, put it in the vial and send it back.

It's so exciting to find matches. Of course, some people get a big surprise, but that's exciting, too.

DNA Results Sites with more imformation than the results

skavboke — 17 Jul 2008 2:59:50 GMT

I am moderating a group in August regarding DNA. We will have already had a speaker on the subject. My goal is to display DNA Results sites where contributors have done more than the results and a lineage.

An example being Georgia Bopp's section on Henry Kenny in the Kenny DNA site.

I want some interesting results sites to share at this meeting or welcome any other ideas which could be appropriate for this type of discussion.

Thanks,
Diane

Needing male Chancey - Chancy - Chauncey DNA for genealogy

Robert Chancey — 29 Jul 2008 1:45:36 GMT

Several of us South Georgia~Florida, Chancy~Chancey's have become involved with using DNA to help us around the stone wall many of us are at.

This DNA group of Chancey's and Chauncey's is not limited to the southern clans...somewhere..there is a bloodline match for all of us, but we must have that Y-DNA (male) sample to compare with our growing Chancey/Chauncey DNA database.

We have so far proven that the 3 main SE Georgia Chancey's are related by bloodline, and the common ancestor is at some period in the 1700s.

We have also proven that we South Georgia Chancey's are not connected by bloodline to the New England Chauncey's, other Chancey branches may very well connect.

We could certainly use some of the other southern (primarily) Chancey's of North Carolina who migrated to SW Georgia and Alabama and beyond in the 1800s.

There are Chancey branches in TN, VA, KY and Westward that could very well tie all of us together.

For additional information how this is accomplished, costs..etc. Please write me at k4yaw at hotmail.com Please put DNA genealogy in the subject line, so that it is not accidentally deleted as spam. I get around 25 to 40 spam mails at Hotmail daily because that is my genealogy contact address..and is posted all over the genealogy forums.

Please try to help our group to grow if you can. Its exciting, and we have already proven much.

Regards, Robert

Should Y-Chromosome Match = Surname Match?

olymau — 16 Apr 2008 5:54:01 GMT

Since the Y-Chromosome is passed down from father to son with the father's surname, should't all Y-Chromosome matches have the same Surname?
If my Y-Chromosome is a close match with someone else, only 2 of 46 Y-Chromosome Markers differ, if we truely are related shouldn't we still have the same surname even though 2 of the markers changed over many generations?
Thank you,
Scott

Update on the Y-DNA Project for the FARRIS Surname Group Which Includes the Surnames of Fairess, Faries, Faris, Farris, etc.

JohnAFarris — 2 Mar 2008 6:07:11 GMT

SUBJECT: Update on the Y-DNA Project for the FARRIS Surname Group Which Includes the Surnames of FAIRESS/FARIES/FARIS/FARRIS/FARRIES/FERRIS/FERRISS/PHARRIS/etc.

(The FARRIS Surname Group has over fifty spellings identified)

I am very pleased to report that we now have twenty-nine (29) participants in our subject project and they all have received their Y-DNA analysis back. These twenty-nine Y-DNA results break down into three different Haplogroups: I1a, I1c & R1b. We have thirteen (13) participants in I1a, one (1) in I1c and fifteen (15) in R1b. We also have eight people who have ordered their Y-DNA test kits, but have not yet mailed them in. I hope that they hurry up & do so soon !!!

The I1a & c Haplogroups are being managed very effectively by my Co-Administrator, Elvin Farris. His thirteen (13) I1a results break down into only two unrelated (at least in a genealogical time frame) clusters. One cluster has eleven related participants (Descendants of Ian Esom Farris), while the other cluster has only two participants. In each cluster the related participants either already know they are related or they are still trying to find out where their branches meet. If you have any questions of these two Haplogroups, Please contact Elvin at <<< Elvin Everett Farris, Jr. (mefarris@bellsouth.net) >>>.

The R1b Haplogroup plus any new Haplogroups that should be identified with the FARRIS/etc. surname group are being managed by me. Within our fifteen R1b participants we have two identified clusters of related people. Mine has seven members who are clearly related -- however, three did not know this until I analyzed their Y-DNA results. We also have two more that may be related, but it will take more testing of additional male relatives to prove it. The other cluster has three participants, one match of which was unexpected. Thus we have four unexpected matches within our R1b participants. This can be very exciting for those participants as it gives them a clear direction for their future research. It can also be a little frustrating if the connection between the two branches is not obvious.

Our results show that the various spellings within our FARRIS surname group are often shown to be related by their Y-DNA results.

Thus far we have identified at least eight unique Y-DNA groups with the FARRIS/etc. surname that came from Europe to the USA. Unfortunately, we do not yet have any participants with an Arab origin. We know they are out there, but none have joined us yet. I hope we will get this corrected soon. The Arab heritage is expected to show a very different Haplogroup. As you may already know, FARRIS in Arabic means "warrior on horseback", and it is a common surname in Arab speaking countries.

This leaves four participants (and perhaps six) that do not yet have a match with any other participant. The solution for helping these four or six strays is to get more participants. The more participants we have the more matches we find and the more problems we solve. Who do you know who is a male with a surname in the FARRIS/etc. surname group as listed above? Talk them into getting tested. If you are a woman, you can sponsor a male. Many of our current participants are women who arranged to have a male tested. In many cases these women remain the primary point of contact for Elvin & me.

To join our study, please go to: <<< www.dnaheritage.com/oracle/join.asp?GroupUnique=873562776 >>> and follow the instructions to order your sample kit. It is a simple, fast, and painless test.

Respectfully submitted,
John

John A. Farris// Albuquerque, NM USA// JohnAFarris@comcast.net

Administrator of the subject project.

Leavitt Y-DNA Project

NALFhistorian — 12 Jul 2008 12:01:32 GMT

The National Association of Leavitt Families (NALF) is an organization formed around the descendants of immigrants John Leavitt of Hingham,MA and Thomas Leavitt of Hampton,NH, both arriving in America in the 1620-30's. Our DNA project was originally started to help us determine if there was any connection between the two men. We welcome any males of the Leavitt, Levett, and Levitt surname (and other variant spellings) that would like to be a part of this undertaking!
As of this writing, we have three non-related Levett/Leavitt lines of English origins.

http://www.familytreedna.com/public/leavitt

John Dow
Historian, NALF

Baltic 204 modal

44040 — 11 Jul 2008 4:43:52 GMT

I have googled this with no luck--what does it mean?

Rapley DNA project

JRapleySauntry — 8 Jul 2008 7:27:44 GMT

Rapley DNA Project to determine Rapley Ancestry and Migration. Our project is hosted by the testing company Family Tree DNA. You can visit their web site at http://www.familytreedna.com/. One Rapley male has been tested there

There is a group discount if you join the "Rapley Surname project".
.To access our group sign-up page, please type Rapley in the search box on the right side of their web page. On the page that is returned, click on the name "Rapley" and an ordering page will be displayed.

Please consider ordering at least the 25-marker kit, as the 12-marker test is considered "low resolution," and often does not provide enough information to determine lineage.

Looking forward to hearing from you.

Jeannette Rapley

Looking For participants for DNA Diaries

StevenMoore151 — 27 Jun 2008 12:53:21 GMT

I am a researcher on the SMG Productions show DNA Stories, and we are looking for people to take part in the programme which helps people trace long-lost relatives through DNA testing.

Due to air in October on Sky Real Lives, it is presented by Lorraine Kelly and this is the second series.

It is filmed in an enclosed studio (no audience) so is designed to be as non-conflict as possible.

To give some examples of people who have contacted us so far, we have heard from by those who have traced their long-lost American GI fathers as well as people who were adopted and think they have found their birth parents.

If you can help, please contact me on emily.henderson@smg.plc.uk or those wishing to participate in the show can call 0871 827 5020, or email dnastories@stv.tv

Swanay/Swaney DNA Project

calgenie — 30 Jun 2008 8:49:47 GMT

I am pleased to announce the Swanay/Swaney (and other variant spellings) DNA Surname Project!

The initial goals of this project are:

1. To determine if the Swanay, Swaney, Swanney, and [other variant spelling] lines are connected.
2. To connect the various lines with their ancestors, and to differentiate between the lines.
5. To find desendants of Miles Swanay and Jane Johnson.
6. To determine if the Tennessee, Kentucky, Ohio, and Pennsylvania lines are related.
7. To identify our immigrant ancestor(s) if possible.
8. To determine our Swanay/Swaney family's native homeland (current data is showing Scotland).
9. To break down those brick walls!

The Swanay/Swaney surname is very rare, so it is difficult to find participants. If you are, or know of, someone with this surname, I hope you/they will consider participating!

In order to participate in the Y-DNA testing, a male participant is required. Many females (like myself) who cannot themselves participate in this study can find a male relative bearing the last name being tested and have this relative represent their line.

We also have participants in a mtDNA project for this surname, but remember that only males carry the Y chromosome and can be linked to the surname.

Testing requires ONLY a simple, painless cheek swab. No needles or blood is required! Also, only DNA pertaining to genealogical research is tested. No medical information is or can be obtained through these tests.

Our project is hosted by the testing company Family Tree DNA. You can visit their web site at http://www.familytreedna.com/.

To access our group sign-up page, please type Swanay or Swaney in the search box on the right side of their web page. On the page that is returned, click on the name "Swanay," and an ordering page will be displayed.

Please consider ordering at least the 25-marker kit, as the 12-marker test is considered "low resolution," and often does not provide enough information to determine lineage.

You can view our public project page at http://www.familytreedna.com/public/swanay.

If you have any questions, please feel free to contact me at: calgenie@verizon.net.

Warmly,

Elizabeth Swanay-O'Neal
Swanay DNA Project Administrator

Announcing the Wigington Surname DNA Project

pjotf — 5 Jun 2007 7:35:03 GMT

My father had his DNA tested in order to try and verify the Wigington lineage his family descends from. Thus far there are only two Wigingtons that have had their DNA tested and they both descend from the same George Wigginton born in VA abt. 1730.

This project is only for males with the surname of Wigington, Wiggington, Wigginton, Wiginton, or any other spelling of our name.

If you are interested in joining the Wigington Surname DNA Project please post a response here and I can send you the details or you can email me directly.

I do not believe I can post the name of the company that hosts the service since that would be advertising, nor can I post the pricing.

Thanks!
Paula

New Hance DNA Project

JamesOgg — 22 Jun 2008 12:25:30 GMT

A new DNA project has been started at FTDNA for Hance descendants.
https://www.familytreedna.com/surname_join.aspx?code=Y40468&...
All name variants are welcome!

DNA Result Interpretation

LouiseThompson77 — 12 Jun 2008 12:53:56 GMT

We just got back the DNA results for my father and I need alot of help! Could someone tell me what this halogroup numbers mean! Thanks a Million!
19a 19b 385a 385b 388 389 1 389 11 390 391 392 393 426 437 438 439 440 441 442 444 445 446 447 448 449 452 454 455 456 458 459a 459b 460 461 462 463 464a 464b 464c 464d 464e 464f GGAATIB07 YCAIIb Y-5ATA-A10 635 Y-GATA-H4 1

A general overview will do . Thanks again

New to mtDNA testing -help...!!!!!

jayneebradley — 1 Jun 2008 11:03:17 GMT

I have just had my maternal DNA tested and given one mutation against the European reference sequence, at position 311 ???

I keep hearing talk of haplogroups ???? Should I have been given this information ???

Join the new J1 Ancestry Group!

RouX_Renard — 8 Jun 2008 10:15:17 GMT

Hi,

A new Group has been created at Ancestry for members of the rare J1 genetic haplogroup.

If YOU are a J1 male (or if you are fortunate enough to be the wife or daughter of one) please join the new "J1 Group" here at Ancestry.com

http://groups.ancestry.com/Home.aspx?mfsid=35988797&att=...

See you there!

regards,

RouX

Kitts Project - DNA TESTING

celticsign1 — 2 Jun 2008 2:42:23 GMT

The Kitts project is just starting up. This is a way to find out who is related to whome and to validate existing reseach. If you are interested in this project please go to http://www.FamilyTreeDNA.com. Thank you

DNA test says J2 but i am a white Englishman, i am confused

gavrelle — 29 May 2008 9:54:21 GMT

Dear All, I got my test back and it says J2, essentially middle east and south europe. I have traced my tree back 400 years and they are all english born etc, surname Tullett/Tulett/Tallett, am i confused or what, any ideas???

DNA test result help

vegasgrl24 — 22 May 2008 2:14:03 GMT

I had DNA test results done by Gene Tree about a year ago and I don't know how to decipher them. It was an ancestry by DNA test. Can anyone help?

Evans family in PA

rebornblessed — 23 May 2008 10:00:40 GMT

The Family of Immigrant Ancestor Richard Evans [1669 - 7 Jan 1702 probate] > Samuel [1691-30 Sep 1770] [area of Maryland and Pennsylvania] are doing DNA testing with very interesting results.
Later descendants migrated to Ohio, West Virginia, Kentucky and other locations.
If you descend from this line of Evanses, please contact us at
listadministratorevans@earthlink.net